ID: 970637104

View in Genome Browser
Species Human (GRCh38)
Location 4:18021668-18021690
Sequence CCGCTCAGTGCCGGAGCCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970637104_970637114 7 Left 970637104 4:18021668-18021690 CCGAGGGCTCCGGCACTGAGCGG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 970637114 4:18021698-18021720 GGCGGCGGCAGCAGCGGCGGCGG 0: 9
1: 107
2: 1354
3: 2117
4: 4013
970637104_970637115 13 Left 970637104 4:18021668-18021690 CCGAGGGCTCCGGCACTGAGCGG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 970637115 4:18021704-18021726 GGCAGCAGCGGCGGCGGCAGCGG 0: 3
1: 27
2: 346
3: 1921
4: 3490
970637104_970637112 1 Left 970637104 4:18021668-18021690 CCGAGGGCTCCGGCACTGAGCGG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 970637112 4:18021692-18021714 GGCGGCGGCGGCGGCAGCAGCGG 0: 16
1: 219
2: 1452
3: 2172
4: 4103
970637104_970637113 4 Left 970637104 4:18021668-18021690 CCGAGGGCTCCGGCACTGAGCGG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 970637113 4:18021695-18021717 GGCGGCGGCGGCAGCAGCGGCGG 0: 7
1: 134
2: 1374
3: 2133
4: 3981
970637104_970637111 -8 Left 970637104 4:18021668-18021690 CCGAGGGCTCCGGCACTGAGCGG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 970637111 4:18021683-18021705 CTGAGCGGCGGCGGCGGCGGCGG 0: 4
1: 23
2: 212
3: 933
4: 3528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970637104 Original CRISPR CCGCTCAGTGCCGGAGCCCT CGG (reversed) Exonic
900094874 1:936284-936306 CCCCTCCGTCCAGGAGCCCTAGG - Intronic
900094923 1:936401-936423 CCCCTCCGTCCAGGAGCCCTAGG - Intronic
901696713 1:11012991-11013013 CCGGACAGTGCCGGAGCCTTCGG + Intronic
902218409 1:14949444-14949466 CTGCTCAGTCCCAGAGCCCATGG - Intronic
902776670 1:18679315-18679337 CTCCTCAGTGCTGGAGCCCTGGG - Intronic
903282133 1:22256042-22256064 CTGCTCAGCCCCGGAGCTCTGGG + Intergenic
903926754 1:26835909-26835931 CCCCACAGGGCAGGAGCCCTGGG - Intronic
904046034 1:27609069-27609091 CAGCTCAGTCCCGGAGCAGTGGG + Intergenic
904466211 1:30709052-30709074 CTGCTCATTGCTGGGGCCCTGGG + Intergenic
906295262 1:44645594-44645616 CAGCTCAGTGCTGCTGCCCTGGG + Intronic
914831957 1:151176720-151176742 CCGCCCACTGCCTCAGCCCTGGG - Exonic
919757147 1:201073357-201073379 CCTCTCAGTGCAGGAGTCCCTGG + Intronic
919981294 1:202644098-202644120 CCGCGGGCTGCCGGAGCCCTCGG - Intronic
922959960 1:229637916-229637938 CTGCTCAGTGCCGGGGGCCCGGG + Exonic
1069582172 10:69573507-69573529 CCAATCAGCGCCGGGGCCCTGGG + Intergenic
1076564270 10:131387349-131387371 CCGGGCAGAGCTGGAGCCCTGGG - Intergenic
1076793338 10:132787730-132787752 CAGCTCAGAGCCCGAGCCTTGGG - Intergenic
1077065920 11:640882-640904 CCACTCAGTTCCGCAGCGCTGGG + Intergenic
1077199235 11:1297073-1297095 CCGGTCAGCGCCAGTGCCCTGGG + Intronic
1082822233 11:57551972-57551994 GCCCTCAGTGCCTGAGCCCTAGG + Exonic
1082986156 11:59172567-59172589 CCGCGCAGCGCCGCAGCCCCGGG + Exonic
1083439241 11:62665205-62665227 CCGCTCAGCGCCGGATCCGCGGG + Intronic
1083553558 11:63608511-63608533 CCGCACAGTGCCAGAGCCGGGGG - Intronic
1084494830 11:69497748-69497770 CCCCTCAGTGCCTGAGACCTGGG + Intergenic
1087122793 11:94592149-94592171 CCACTCAGTACTGGATCCCTGGG - Intronic
1089129256 11:116199329-116199351 CGGCTCTGTGCCAGAGCCCTGGG - Intergenic
1089314720 11:117583630-117583652 CCCATCAGCCCCGGAGCCCTTGG + Intronic
1090075517 11:123578097-123578119 CCCCTGAGTACCGGGGCCCTTGG + Intronic
1091124570 11:133082993-133083015 CCCGTCAGCGCCGGAGCCCGCGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1102933381 12:116878981-116879003 CCGCTCTGCGCCGGAGCGCAGGG - Intronic
1115331281 14:32201446-32201468 CCACTCAGTTCTGGAGCCGTCGG - Intergenic
1122857961 14:104568967-104568989 GGGCTGAGTGCAGGAGCCCTGGG - Intronic
1123930750 15:25170642-25170664 CAGCTCAGTGCAGGAGGCCAGGG - Intergenic
1123936704 15:25197489-25197511 CAGCTCAGTGCAGGAGACCAGGG - Intergenic
1123940743 15:25215461-25215483 CAGCTCAGTGCAGGAGCCAAGGG - Intergenic
1123942890 15:25225122-25225144 CAGCTCAGTGCAGGAGACCAGGG - Intergenic
1123944459 15:25232307-25232329 CAGCTCAGTGCAGGAGACCAGGG - Intergenic
1123944878 15:25234165-25234187 CAGCTCAGTGCAGGAGACCACGG - Intergenic
1123947393 15:25245397-25245419 CAGCTCAGTGCAGGAGACCAGGG - Intergenic
1123947789 15:25247264-25247286 CAGCTCAGTGCAGGAGACCAGGG - Intergenic
1123948222 15:25249123-25249145 CAGCTCAGTGCAGGAGACCAGGG - Intergenic
1123948602 15:25250790-25250812 CAGCTCAGTGCAGGAGACCAGGG - Intergenic
1124496996 15:30192833-30192855 CCGCGGGCTGCCGGAGCCCTCGG - Intergenic
1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG + Intergenic
1127366635 15:58297542-58297564 CCACCCAGTGCCAGAGCCTTGGG - Intronic
1128372398 15:67049895-67049917 CAGCACAGTTCCAGAGCCCTGGG - Intergenic
1129235815 15:74223146-74223168 CCCCTCAGTGCTGGACCCTTGGG + Intergenic
1129455721 15:75675379-75675401 CCACTCTGTCCCGGACCCCTGGG + Exonic
1131114297 15:89784570-89784592 CCACTCACTGCGGGAGCACTGGG + Intergenic
1132590562 16:724582-724604 CTGAGCAGTGCCGGGGCCCTGGG + Intronic
1132761208 16:1509404-1509426 CCGCACACTGCCAGAGCTCTTGG - Intronic
1134043189 16:11083549-11083571 CCACTCAGCTCCAGAGCCCTCGG + Intronic
1138105215 16:54284351-54284373 GCGCTCGGTGCCGGCGCCCAGGG + Intronic
1139586830 16:67909306-67909328 ACGCTCGGTGAAGGAGCCCTTGG - Exonic
1142197572 16:88745873-88745895 TCCCCCAGAGCCGGAGCCCTTGG + Intronic
1143097591 17:4486608-4486630 CGGCTCAGGGCCGGCACCCTAGG + Intronic
1145021456 17:19434817-19434839 CCACTCAGTGCCGAAGCAGTTGG - Intergenic
1145065816 17:19760388-19760410 ATGCTCAGCGCCAGAGCCCTCGG + Intergenic
1147586508 17:41656366-41656388 CGGCTGAGTGCAGGAGCCCAGGG + Intergenic
1148637055 17:49156871-49156893 CCACGCAGTGCCAGAGCCCATGG - Intronic
1150585355 17:66512586-66512608 CCGCCCAGGGCAGCAGCCCTGGG - Intronic
1151572971 17:74936332-74936354 CTGCTGAGTGCGGGCGCCCTCGG - Intronic
1151979227 17:77498991-77499013 GTTCTCAGTGCCGGAGGCCTTGG + Exonic
1152111407 17:78359499-78359521 CCGCTCAGTCCAGTAGCCCCGGG + Intronic
1152609100 17:81306947-81306969 CCGCCCAGTGCCAGAGCCGGGGG + Intergenic
1152884576 17:82842088-82842110 CCGCTGAGAGGTGGAGCCCTCGG - Intronic
1160721329 19:598128-598150 CCACTCGGTGCTGGGGCCCTGGG + Intronic
1160866476 19:1258411-1258433 CCTCTCAGTGCCCCTGCCCTAGG + Exonic
1161291193 19:3494191-3494213 CCCCACAGTGGCAGAGCCCTGGG - Intronic
1164693834 19:30228811-30228833 CCGGGCAGTCCCGGAGCCCGCGG - Intronic
1165278198 19:34772907-34772929 CAGCCCAGAGCCGGAGCCCGGGG - Exonic
926366859 2:12141106-12141128 CAGCACACTGCCAGAGCCCTGGG - Intergenic
927465347 2:23332372-23332394 CCACTCACTGCAGGAGGCCTGGG + Intergenic
932448031 2:71792507-71792529 CTGCTTGGTGCCTGAGCCCTGGG - Intergenic
938258513 2:129878609-129878631 CTGCTCAGCGCAGGACCCCTGGG + Intergenic
945039891 2:205734828-205734850 CAGCGCAGTGCTGGAGCCCTGGG - Intronic
946420373 2:219561346-219561368 AGGTTCAGTGCCGGAGACCTCGG - Intronic
1170214452 20:13876784-13876806 ACGCTCAGAGGAGGAGCCCTGGG + Intronic
1174587082 20:51617762-51617784 CTGCTCAGTGCCGGGACCCTTGG - Intronic
1175253741 20:57625736-57625758 CCAGTCAGTGCTGGGGCCCTAGG - Intergenic
1176290779 21:5043566-5043588 CCACTCAGAGCCTGAGCCCTTGG + Intergenic
1176373544 21:6076464-6076486 CCTCTCAGTTCCGGAGGCCGGGG - Intergenic
1179257245 21:39727515-39727537 CCGCTCAGGGTCTGAGCTCTTGG - Intergenic
1179534105 21:42040187-42040209 CCTCTCAGCGCCAGAGCCCCAGG - Intergenic
1179749933 21:43461779-43461801 CCTCTCAGTTCCGGAGGCCGGGG + Intergenic
1179866476 21:44220075-44220097 CCACTCAGAGCCTGAGCCCTTGG - Intergenic
1181162221 22:20965680-20965702 CCGATCTGGGCAGGAGCCCTTGG + Intronic
1181681708 22:24499964-24499986 GCGCTCAGTGCCAGGGCCCAAGG - Intronic
1181690201 22:24555012-24555034 CCGCTCTGGGCCGGGGCCATGGG - Intronic
1184607141 22:45580659-45580681 CCGCCCAGAGCCGGAGCCCAGGG + Intronic
1184684481 22:46089958-46089980 CCGCTCTGTGCCGACGCCCTCGG - Intronic
950219798 3:11185883-11185905 CCAGCAAGTGCCGGAGCCCTGGG - Intronic
950412479 3:12848153-12848175 CTGCTCAGCCCTGGAGCCCTGGG - Intronic
953458585 3:43063280-43063302 CTCCTCAGTGCAGGAGCTCTGGG + Intergenic
954384188 3:50235946-50235968 CCGCCCAGTGCCGGGTCCCGGGG + Exonic
954614071 3:51960598-51960620 GCGTTCAGGGCAGGAGCCCTCGG + Exonic
955960771 3:64339477-64339499 CCTCTCCGTCCCTGAGCCCTAGG - Intronic
961594678 3:128006903-128006925 CCTCTGGGAGCCGGAGCCCTGGG - Intergenic
970637104 4:18021668-18021690 CCGCTCAGTGCCGGAGCCCTCGG - Exonic
972365310 4:38368988-38369010 CAGGTCAGTGCTGGAGCACTGGG - Intergenic
975485713 4:74932951-74932973 CCGCTCTGGGCCGGGGCTCTCGG + Intergenic
975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG + Intergenic
976471263 4:85431390-85431412 CCAGTCAGTGCCAGAGCTCTAGG + Intergenic
984317096 4:178141561-178141583 TCGCTCAGGGCAGAAGCCCTTGG + Intergenic
985789774 5:1919266-1919288 CCTCTCAGAGCAGGTGCCCTGGG + Intergenic
992002179 5:72446530-72446552 CTTCTCAGTCCCAGAGCCCTTGG - Intronic
997466374 5:134090640-134090662 CCGCTCAAGGTCGCAGCCCTTGG + Intergenic
999747092 5:154600738-154600760 ACACTCTGTGCCAGAGCCCTGGG + Intergenic
1003418113 6:5931170-5931192 CCACTCAGTGCCTCTGCCCTTGG + Intergenic
1013978306 6:116101192-116101214 CCGCTCCGCGCCGGTGCCGTGGG + Intronic
1014075823 6:117233099-117233121 CTGCTCAGTGAAGGTGCCCTAGG - Intergenic
1015773361 6:136791459-136791481 CCGCCCAGCGCTGGAGCCCTGGG - Intronic
1018085524 6:160298025-160298047 CAAGTCAGTGGCGGAGCCCTGGG - Intergenic
1019336256 7:484438-484460 CTGCTCAGGGCCAGAGCCTTGGG + Intergenic
1019496399 7:1342389-1342411 CGGCTCTGTGCCGAGGCCCTGGG + Intergenic
1020097128 7:5375520-5375542 GCTCTCAGAGCCTGAGCCCTGGG - Intronic
1023640290 7:42250601-42250623 CCCCTCATTGCTGGAGCCTTGGG + Intergenic
1023852738 7:44159266-44159288 CCTTTCAGTGCAGAAGCCCTGGG - Exonic
1026396062 7:69955568-69955590 CCGCTCAGTGGCAGAGGGCTGGG + Intronic
1034077096 7:148242699-148242721 CTGCTCTGTCCCTGAGCCCTGGG + Intronic
1035221904 7:157411176-157411198 CCGCTCAGTGCAGGGACCCTGGG - Intronic
1035221942 7:157411289-157411311 CCGCTCAGTGCAGGGATCCTGGG - Intronic
1035221966 7:157411364-157411386 CCGCTCAGTGCAGGGATCCTGGG - Intronic
1035221977 7:157411401-157411423 CCGCTCAGTGCAGGGATCCTGGG - Intronic
1035221989 7:157411439-157411461 CCGCTCAGTGCAGGGATCCTGGG - Intronic
1035443043 7:158919884-158919906 CTGCTCAGTGTCGGCTCCCTGGG - Intronic
1035670021 8:1409851-1409873 CCCCTCAGTGCCGGGGCCTTCGG + Intergenic
1037787431 8:21911232-21911254 CCTCCCACTGCCGGGGCCCTGGG + Intronic
1041673698 8:60517177-60517199 CCGCTCAGTGCCAGGGCACACGG - Exonic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1056216265 9:84408587-84408609 CCCCTCACTGCCGGAGCCGGCGG - Intergenic
1058109682 9:101018538-101018560 CCCCGCAGTGCAGGAGCCCTTGG + Intergenic
1192227713 X:69240906-69240928 ACACTCAGTGCTAGAGCCCTGGG + Intergenic
1200233918 X:154459211-154459233 CCTCTCAGTGCCAGAGCTCCCGG - Intronic