ID: 970637555

View in Genome Browser
Species Human (GRCh38)
Location 4:18025294-18025316
Sequence GGATTCACTGACTGTCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970637553_970637555 5 Left 970637553 4:18025266-18025288 CCTGTCAGCAAGGCAGCTCTGTT No data
Right 970637555 4:18025294-18025316 GGATTCACTGACTGTCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970637555 Original CRISPR GGATTCACTGACTGTCAGCT AGG Intergenic
No off target data available for this crispr