ID: 970638387

View in Genome Browser
Species Human (GRCh38)
Location 4:18035938-18035960
Sequence CAGATACAGCATGATGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970638383_970638387 0 Left 970638383 4:18035915-18035937 CCAGATAAATACAAGACAAAAGG No data
Right 970638387 4:18035938-18035960 CAGATACAGCATGATGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970638387 Original CRISPR CAGATACAGCATGATGAGTG GGG Intergenic
No off target data available for this crispr