ID: 970643250

View in Genome Browser
Species Human (GRCh38)
Location 4:18090677-18090699
Sequence CACCTGCCATTGCTGAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970643248_970643250 -10 Left 970643248 4:18090664-18090686 CCTGGAGAAGGGGCACCTGCCAT No data
Right 970643250 4:18090677-18090699 CACCTGCCATTGCTGAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970643250 Original CRISPR CACCTGCCATTGCTGAGGCT CGG Intergenic
No off target data available for this crispr