ID: 970644668

View in Genome Browser
Species Human (GRCh38)
Location 4:18106664-18106686
Sequence GAGGCTAGGCTTTCGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970644657_970644668 29 Left 970644657 4:18106612-18106634 CCCAGTGATGAGTTCAGAATAGG No data
Right 970644668 4:18106664-18106686 GAGGCTAGGCTTTCGGGAAGAGG No data
970644659_970644668 28 Left 970644659 4:18106613-18106635 CCAGTGATGAGTTCAGAATAGGC No data
Right 970644668 4:18106664-18106686 GAGGCTAGGCTTTCGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970644668 Original CRISPR GAGGCTAGGCTTTCGGGAAG AGG Intergenic
No off target data available for this crispr