ID: 970644954

View in Genome Browser
Species Human (GRCh38)
Location 4:18109047-18109069
Sequence GAGCCCAATTTGCCAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970644954_970644956 8 Left 970644954 4:18109047-18109069 CCTGCTTCTGGCAAATTGGGCTC No data
Right 970644956 4:18109078-18109100 AGCCATAGGCAGATCAGCCTTGG No data
970644954_970644957 9 Left 970644954 4:18109047-18109069 CCTGCTTCTGGCAAATTGGGCTC No data
Right 970644957 4:18109079-18109101 GCCATAGGCAGATCAGCCTTGGG No data
970644954_970644955 -6 Left 970644954 4:18109047-18109069 CCTGCTTCTGGCAAATTGGGCTC No data
Right 970644955 4:18109064-18109086 GGGCTCTCAGCAGTAGCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970644954 Original CRISPR GAGCCCAATTTGCCAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr