ID: 970647732

View in Genome Browser
Species Human (GRCh38)
Location 4:18142058-18142080
Sequence TAGGGAGCACTGAAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970647726_970647732 1 Left 970647726 4:18142034-18142056 CCTTTGCCTGCTTTCTTCTGTCA No data
Right 970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG No data
970647723_970647732 29 Left 970647723 4:18142006-18142028 CCCAGGTTCAAACTGCAGTTCAT No data
Right 970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG No data
970647728_970647732 -5 Left 970647728 4:18142040-18142062 CCTGCTTTCTTCTGTCAATAGGG No data
Right 970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG No data
970647724_970647732 28 Left 970647724 4:18142007-18142029 CCAGGTTCAAACTGCAGTTCATA No data
Right 970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970647732 Original CRISPR TAGGGAGCACTGAAGGAGGT TGG Intergenic
No off target data available for this crispr