ID: 970648862

View in Genome Browser
Species Human (GRCh38)
Location 4:18155898-18155920
Sequence TTCCTCCCCTAGAAGAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970648860_970648862 -6 Left 970648860 4:18155881-18155903 CCTTCCAGCAGAAATCTTTCCTC No data
Right 970648862 4:18155898-18155920 TTCCTCCCCTAGAAGAAGTAAGG No data
970648861_970648862 -10 Left 970648861 4:18155885-18155907 CCAGCAGAAATCTTTCCTCCCCT No data
Right 970648862 4:18155898-18155920 TTCCTCCCCTAGAAGAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970648862 Original CRISPR TTCCTCCCCTAGAAGAAGTA AGG Intergenic
No off target data available for this crispr