ID: 970659069

View in Genome Browser
Species Human (GRCh38)
Location 4:18264251-18264273
Sequence CTGGAGACACAGAGAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970659067_970659069 -6 Left 970659067 4:18264234-18264256 CCTTCTTCACAAGGTGGCTGGAG No data
Right 970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970659069 Original CRISPR CTGGAGACACAGAGAGTGAA GGG Intergenic
No off target data available for this crispr