ID: 970659329

View in Genome Browser
Species Human (GRCh38)
Location 4:18266179-18266201
Sequence CAAAATGCTGATAGTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970659329_970659331 -5 Left 970659329 4:18266179-18266201 CCAATATCACTATCAGCATTTTG No data
Right 970659331 4:18266197-18266219 TTTTGGTCAAAACAATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970659329 Original CRISPR CAAAATGCTGATAGTGATAT TGG (reversed) Intergenic