ID: 970660807

View in Genome Browser
Species Human (GRCh38)
Location 4:18283498-18283520
Sequence GGTGGCATGCTCATTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970660800_970660807 27 Left 970660800 4:18283448-18283470 CCTAAACTAGTCCAATCAAACTA No data
Right 970660807 4:18283498-18283520 GGTGGCATGCTCATTCCTGTTGG No data
970660801_970660807 16 Left 970660801 4:18283459-18283481 CCAATCAAACTAGAACTCCAGAC No data
Right 970660807 4:18283498-18283520 GGTGGCATGCTCATTCCTGTTGG No data
970660803_970660807 -1 Left 970660803 4:18283476-18283498 CCAGACTTCTGTTTGGCAGTTGG No data
Right 970660807 4:18283498-18283520 GGTGGCATGCTCATTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970660807 Original CRISPR GGTGGCATGCTCATTCCTGT TGG Intergenic
No off target data available for this crispr