ID: 970663105

View in Genome Browser
Species Human (GRCh38)
Location 4:18308115-18308137
Sequence CAGCCAGCAGAGCATGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970663101_970663105 -10 Left 970663101 4:18308102-18308124 CCCCAGTGCAGGACAGCCAGCAG No data
Right 970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG No data
970663100_970663105 -9 Left 970663100 4:18308101-18308123 CCCCCAGTGCAGGACAGCCAGCA No data
Right 970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970663105 Original CRISPR CAGCCAGCAGAGCATGTCCT GGG Intergenic
No off target data available for this crispr