ID: 970664841

View in Genome Browser
Species Human (GRCh38)
Location 4:18324860-18324882
Sequence ATAATACTTACTTGGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970664841_970664844 9 Left 970664841 4:18324860-18324882 CCTGCATTCCAAGTAAGTATTAT No data
Right 970664844 4:18324892-18324914 GCTCAAATGTCTGTCAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970664841 Original CRISPR ATAATACTTACTTGGAATGC AGG (reversed) Intergenic
No off target data available for this crispr