ID: 970668184 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:18362332-18362354 |
| Sequence | CTAGGCTTGTTCATTGCTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970668182_970668184 | -8 | Left | 970668182 | 4:18362317-18362339 | CCCAAGATCTAGGTACTAGGCTT | No data | ||
| Right | 970668184 | 4:18362332-18362354 | CTAGGCTTGTTCATTGCTACTGG | No data | ||||
| 970668183_970668184 | -9 | Left | 970668183 | 4:18362318-18362340 | CCAAGATCTAGGTACTAGGCTTG | No data | ||
| Right | 970668184 | 4:18362332-18362354 | CTAGGCTTGTTCATTGCTACTGG | No data | ||||
| 970668181_970668184 | -7 | Left | 970668181 | 4:18362316-18362338 | CCCCAAGATCTAGGTACTAGGCT | No data | ||
| Right | 970668184 | 4:18362332-18362354 | CTAGGCTTGTTCATTGCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970668184 | Original CRISPR | CTAGGCTTGTTCATTGCTAC TGG | Intergenic | ||