ID: 970668184

View in Genome Browser
Species Human (GRCh38)
Location 4:18362332-18362354
Sequence CTAGGCTTGTTCATTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970668182_970668184 -8 Left 970668182 4:18362317-18362339 CCCAAGATCTAGGTACTAGGCTT No data
Right 970668184 4:18362332-18362354 CTAGGCTTGTTCATTGCTACTGG No data
970668183_970668184 -9 Left 970668183 4:18362318-18362340 CCAAGATCTAGGTACTAGGCTTG No data
Right 970668184 4:18362332-18362354 CTAGGCTTGTTCATTGCTACTGG No data
970668181_970668184 -7 Left 970668181 4:18362316-18362338 CCCCAAGATCTAGGTACTAGGCT No data
Right 970668184 4:18362332-18362354 CTAGGCTTGTTCATTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970668184 Original CRISPR CTAGGCTTGTTCATTGCTAC TGG Intergenic