ID: 970671562

View in Genome Browser
Species Human (GRCh38)
Location 4:18402325-18402347
Sequence CCTGATATGCAGGCTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970671555_970671562 13 Left 970671555 4:18402289-18402311 CCAAATAGGGATTTTTCTCTTTG No data
Right 970671562 4:18402325-18402347 CCTGATATGCAGGCTTTTGAGGG No data
970671554_970671562 22 Left 970671554 4:18402280-18402302 CCTGGGATACCAAATAGGGATTT No data
Right 970671562 4:18402325-18402347 CCTGATATGCAGGCTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970671562 Original CRISPR CCTGATATGCAGGCTTTTGA GGG Intergenic
No off target data available for this crispr