ID: 970681375

View in Genome Browser
Species Human (GRCh38)
Location 4:18512330-18512352
Sequence AGGGAGAAGAAGAAGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970681375_970681382 28 Left 970681375 4:18512330-18512352 CCTCTTCTCTTCTTCTTCTCCCT No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970681375 Original CRISPR AGGGAGAAGAAGAAGAGAAG AGG (reversed) Intergenic