ID: 970681376

View in Genome Browser
Species Human (GRCh38)
Location 4:18512349-18512371
Sequence GAGTAAAAGGAAAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970681376_970681384 28 Left 970681376 4:18512349-18512371 CCCTCCTCTTTTTCCTTTTACTC No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681376_970681382 9 Left 970681376 4:18512349-18512371 CCCTCCTCTTTTTCCTTTTACTC No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970681376 Original CRISPR GAGTAAAAGGAAAAAGAGGA GGG (reversed) Intergenic