ID: 970681377

View in Genome Browser
Species Human (GRCh38)
Location 4:18512350-18512372
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970681377_970681382 8 Left 970681377 4:18512350-18512372 CCTCCTCTTTTTCCTTTTACTCA No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data
970681377_970681384 27 Left 970681377 4:18512350-18512372 CCTCCTCTTTTTCCTTTTACTCA No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970681377 Original CRISPR TGAGTAAAAGGAAAAAGAGG AGG (reversed) Intergenic