ID: 970681378

View in Genome Browser
Species Human (GRCh38)
Location 4:18512353-18512375
Sequence GGATGAGTAAAAGGAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970681378_970681384 24 Left 970681378 4:18512353-18512375 CCTCTTTTTCCTTTTACTCATCC No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681378_970681382 5 Left 970681378 4:18512353-18512375 CCTCTTTTTCCTTTTACTCATCC No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970681378 Original CRISPR GGATGAGTAAAAGGAAAAAG AGG (reversed) Intergenic