ID: 970681382

View in Genome Browser
Species Human (GRCh38)
Location 4:18512381-18512403
Sequence TTCCTCTTTTCAGAGTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970681378_970681382 5 Left 970681378 4:18512353-18512375 CCTCTTTTTCCTTTTACTCATCC No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data
970681375_970681382 28 Left 970681375 4:18512330-18512352 CCTCTTCTCTTCTTCTTCTCCCT No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data
970681379_970681382 -4 Left 970681379 4:18512362-18512384 CCTTTTACTCATCCTCCTCTTCC No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data
970681376_970681382 9 Left 970681376 4:18512349-18512371 CCCTCCTCTTTTTCCTTTTACTC No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data
970681377_970681382 8 Left 970681377 4:18512350-18512372 CCTCCTCTTTTTCCTTTTACTCA No data
Right 970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970681382 Original CRISPR TTCCTCTTTTCAGAGTAAAG AGG Intergenic