ID: 970681384

View in Genome Browser
Species Human (GRCh38)
Location 4:18512400-18512422
Sequence GAGGCAACAGAAAAGTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970681376_970681384 28 Left 970681376 4:18512349-18512371 CCCTCCTCTTTTTCCTTTTACTC No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681377_970681384 27 Left 970681377 4:18512350-18512372 CCTCCTCTTTTTCCTTTTACTCA No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681378_970681384 24 Left 970681378 4:18512353-18512375 CCTCTTTTTCCTTTTACTCATCC No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681383_970681384 -6 Left 970681383 4:18512383-18512405 CCTCTTTTCAGAGTAAAGAGGCA No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681381_970681384 0 Left 970681381 4:18512377-18512399 CCTCTTCCTCTTTTCAGAGTAAA No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681379_970681384 15 Left 970681379 4:18512362-18512384 CCTTTTACTCATCCTCCTCTTCC No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data
970681380_970681384 3 Left 970681380 4:18512374-18512396 CCTCCTCTTCCTCTTTTCAGAGT No data
Right 970681384 4:18512400-18512422 GAGGCAACAGAAAAGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970681384 Original CRISPR GAGGCAACAGAAAAGTTCAA AGG Intergenic