ID: 970689695

View in Genome Browser
Species Human (GRCh38)
Location 4:18608354-18608376
Sequence GTTCCTTCACACATGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970689695_970689698 -3 Left 970689695 4:18608354-18608376 CCAGTTTCCATGTGTGAAGGAAC No data
Right 970689698 4:18608374-18608396 AACTGGAAACTGACAACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970689695 Original CRISPR GTTCCTTCACACATGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr