ID: 970692026

View in Genome Browser
Species Human (GRCh38)
Location 4:18630900-18630922
Sequence TCACGCTGGCCTGCGAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970692018_970692026 4 Left 970692018 4:18630873-18630895 CCCTCAGAGCCTGTGCCCACCCA No data
Right 970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG No data
970692017_970692026 16 Left 970692017 4:18630861-18630883 CCGAGTGTAGGGCCCTCAGAGCC No data
Right 970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG No data
970692020_970692026 -5 Left 970692020 4:18630882-18630904 CCTGTGCCCACCCAGAACTCACG No data
Right 970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG No data
970692016_970692026 21 Left 970692016 4:18630856-18630878 CCGCTCCGAGTGTAGGGCCCTCA No data
Right 970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG No data
970692019_970692026 3 Left 970692019 4:18630874-18630896 CCTCAGAGCCTGTGCCCACCCAG No data
Right 970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970692026 Original CRISPR TCACGCTGGCCTGCGAGCGC AGG Intergenic
No off target data available for this crispr