ID: 970693890

View in Genome Browser
Species Human (GRCh38)
Location 4:18652896-18652918
Sequence TGTGATACACTGTGAATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970693888_970693890 21 Left 970693888 4:18652852-18652874 CCACGGTTTGAAAATCATGGTTT No data
Right 970693890 4:18652896-18652918 TGTGATACACTGTGAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970693890 Original CRISPR TGTGATACACTGTGAATATC TGG Intergenic
No off target data available for this crispr