ID: 970698733

View in Genome Browser
Species Human (GRCh38)
Location 4:18709686-18709708
Sequence TGACATGACCAGTGGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970698733_970698737 -3 Left 970698733 4:18709686-18709708 CCCTGGTCCCACTGGTCATGTCA No data
Right 970698737 4:18709706-18709728 TCATATACTTTATGATCCAAAGG No data
970698733_970698738 4 Left 970698733 4:18709686-18709708 CCCTGGTCCCACTGGTCATGTCA No data
Right 970698738 4:18709713-18709735 CTTTATGATCCAAAGGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970698733 Original CRISPR TGACATGACCAGTGGGACCA GGG (reversed) Intergenic
No off target data available for this crispr