ID: 970701756

View in Genome Browser
Species Human (GRCh38)
Location 4:18749798-18749820
Sequence CCACTGAAACAGCTCTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970701752_970701756 -8 Left 970701752 4:18749783-18749805 CCCTACCTCTGCTTTCCACTGAA No data
Right 970701756 4:18749798-18749820 CCACTGAAACAGCTCTAGCAAGG No data
970701753_970701756 -9 Left 970701753 4:18749784-18749806 CCTACCTCTGCTTTCCACTGAAA No data
Right 970701756 4:18749798-18749820 CCACTGAAACAGCTCTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970701756 Original CRISPR CCACTGAAACAGCTCTAGCA AGG Intergenic
No off target data available for this crispr