ID: 970704991

View in Genome Browser
Species Human (GRCh38)
Location 4:18790047-18790069
Sequence TCTCTTGGTTGTAGTCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970704991_970704994 -9 Left 970704991 4:18790047-18790069 CCTCCGTGACTACAACCAAGAGA No data
Right 970704994 4:18790061-18790083 ACCAAGAGAGAGAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970704991 Original CRISPR TCTCTTGGTTGTAGTCACGG AGG (reversed) Intergenic