ID: 970705273

View in Genome Browser
Species Human (GRCh38)
Location 4:18794128-18794150
Sequence GTGTGTGTGTGGTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970705273_970705282 23 Left 970705273 4:18794128-18794150 CCCTCTTCCCACCACACACACAC No data
Right 970705282 4:18794174-18794196 TAGGCCTTAGTACACCTGTGGGG No data
970705273_970705280 21 Left 970705273 4:18794128-18794150 CCCTCTTCCCACCACACACACAC No data
Right 970705280 4:18794172-18794194 GTTAGGCCTTAGTACACCTGTGG No data
970705273_970705283 24 Left 970705273 4:18794128-18794150 CCCTCTTCCCACCACACACACAC No data
Right 970705283 4:18794175-18794197 AGGCCTTAGTACACCTGTGGGGG No data
970705273_970705281 22 Left 970705273 4:18794128-18794150 CCCTCTTCCCACCACACACACAC No data
Right 970705281 4:18794173-18794195 TTAGGCCTTAGTACACCTGTGGG No data
970705273_970705278 4 Left 970705273 4:18794128-18794150 CCCTCTTCCCACCACACACACAC No data
Right 970705278 4:18794155-18794177 ATCCATGATGATATAATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970705273 Original CRISPR GTGTGTGTGTGGTGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr