ID: 970708512

View in Genome Browser
Species Human (GRCh38)
Location 4:18834095-18834117
Sequence GGCCTAATGGGATCATGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970708512_970708520 24 Left 970708512 4:18834095-18834117 CCACATCATGATCCCATTAGGCC No data
Right 970708520 4:18834142-18834164 TTTCAACGTGAGATTTGGAGGGG 0: 28
1: 968
2: 1766
3: 3047
4: 7286
970708512_970708518 22 Left 970708512 4:18834095-18834117 CCACATCATGATCCCATTAGGCC No data
Right 970708518 4:18834140-18834162 GATTTCAACGTGAGATTTGGAGG No data
970708512_970708519 23 Left 970708512 4:18834095-18834117 CCACATCATGATCCCATTAGGCC No data
Right 970708519 4:18834141-18834163 ATTTCAACGTGAGATTTGGAGGG 0: 39
1: 1094
2: 2399
3: 6611
4: 16614
970708512_970708515 -7 Left 970708512 4:18834095-18834117 CCACATCATGATCCCATTAGGCC No data
Right 970708515 4:18834111-18834133 TTAGGCCATGTCTTCAACACTGG No data
970708512_970708517 19 Left 970708512 4:18834095-18834117 CCACATCATGATCCCATTAGGCC No data
Right 970708517 4:18834137-18834159 TCAGATTTCAACGTGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970708512 Original CRISPR GGCCTAATGGGATCATGATG TGG (reversed) Intergenic
No off target data available for this crispr