ID: 970709298

View in Genome Browser
Species Human (GRCh38)
Location 4:18843084-18843106
Sequence CCACGAATGGCAGGTGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709298_970709307 22 Left 970709298 4:18843084-18843106 CCTATGGCACCTGCCATTCGTGG No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970709298 Original CRISPR CCACGAATGGCAGGTGCCAT AGG (reversed) Intergenic