ID: 970709298 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:18843084-18843106 |
Sequence | CCACGAATGGCAGGTGCCAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
970709298_970709307 | 22 | Left | 970709298 | 4:18843084-18843106 | CCTATGGCACCTGCCATTCGTGG | No data | ||
Right | 970709307 | 4:18843129-18843151 | ACAAGAAGAATGAAGTTACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
970709298 | Original CRISPR | CCACGAATGGCAGGTGCCAT AGG (reversed) | Intergenic | ||