ID: 970709302

View in Genome Browser
Species Human (GRCh38)
Location 4:18843093-18843115
Sequence ACCCAGGATCCACGAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709302_970709307 13 Left 970709302 4:18843093-18843115 CCTGCCATTCGTGGATCCTGGGT No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970709302 Original CRISPR ACCCAGGATCCACGAATGGC AGG (reversed) Intergenic