ID: 970709303

View in Genome Browser
Species Human (GRCh38)
Location 4:18843097-18843119
Sequence AAGAACCCAGGATCCACGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709303_970709308 30 Left 970709303 4:18843097-18843119 CCATTCGTGGATCCTGGGTTCTT No data
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data
970709303_970709307 9 Left 970709303 4:18843097-18843119 CCATTCGTGGATCCTGGGTTCTT No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970709303 Original CRISPR AAGAACCCAGGATCCACGAA TGG (reversed) Intergenic