ID: 970709303 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:18843097-18843119 |
| Sequence | AAGAACCCAGGATCCACGAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970709303_970709308 | 30 | Left | 970709303 | 4:18843097-18843119 | CCATTCGTGGATCCTGGGTTCTT | No data | ||
| Right | 970709308 | 4:18843150-18843172 | GGACAACCAAAGAGTGAGCAAGG | No data | ||||
| 970709303_970709307 | 9 | Left | 970709303 | 4:18843097-18843119 | CCATTCGTGGATCCTGGGTTCTT | No data | ||
| Right | 970709307 | 4:18843129-18843151 | ACAAGAAGAATGAAGTTACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970709303 | Original CRISPR | AAGAACCCAGGATCCACGAA TGG (reversed) | Intergenic | ||