ID: 970709304

View in Genome Browser
Species Human (GRCh38)
Location 4:18843109-18843131
Sequence TGTACATGGGACAAGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709304_970709308 18 Left 970709304 4:18843109-18843131 CCTGGGTTCTTGTCCCATGTACA No data
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data
970709304_970709307 -3 Left 970709304 4:18843109-18843131 CCTGGGTTCTTGTCCCATGTACA No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970709304 Original CRISPR TGTACATGGGACAAGAACCC AGG (reversed) Intergenic
No off target data available for this crispr