ID: 970709305

View in Genome Browser
Species Human (GRCh38)
Location 4:18843122-18843144
Sequence ACTTCATTCTTCTTGTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709305_970709308 5 Left 970709305 4:18843122-18843144 CCCATGTACAAGAAGAATGAAGT No data
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970709305 Original CRISPR ACTTCATTCTTCTTGTACAT GGG (reversed) Intergenic