ID: 970709306

View in Genome Browser
Species Human (GRCh38)
Location 4:18843123-18843145
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 15, 3: 85, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709306_970709308 4 Left 970709306 4:18843123-18843145 CCATGTACAAGAAGAATGAAGTT 0: 1
1: 0
2: 15
3: 85
4: 440
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970709306 Original CRISPR AACTTCATTCTTCTTGTACA TGG (reversed) Intergenic