ID: 970709306

View in Genome Browser
Species Human (GRCh38)
Location 4:18843123-18843145
Sequence AACTTCATTCTTCTTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709306_970709308 4 Left 970709306 4:18843123-18843145 CCATGTACAAGAAGAATGAAGTT No data
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970709306 Original CRISPR AACTTCATTCTTCTTGTACA TGG (reversed) Intergenic