ID: 970709307

View in Genome Browser
Species Human (GRCh38)
Location 4:18843129-18843151
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709304_970709307 -3 Left 970709304 4:18843109-18843131 CCTGGGTTCTTGTCCCATGTACA No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data
970709303_970709307 9 Left 970709303 4:18843097-18843119 CCATTCGTGGATCCTGGGTTCTT No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data
970709302_970709307 13 Left 970709302 4:18843093-18843115 CCTGCCATTCGTGGATCCTGGGT No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data
970709298_970709307 22 Left 970709298 4:18843084-18843106 CCTATGGCACCTGCCATTCGTGG No data
Right 970709307 4:18843129-18843151 ACAAGAAGAATGAAGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type