ID: 970709308

View in Genome Browser
Species Human (GRCh38)
Location 4:18843150-18843172
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970709306_970709308 4 Left 970709306 4:18843123-18843145 CCATGTACAAGAAGAATGAAGTT 0: 1
1: 0
2: 15
3: 85
4: 440
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data
970709304_970709308 18 Left 970709304 4:18843109-18843131 CCTGGGTTCTTGTCCCATGTACA No data
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data
970709303_970709308 30 Left 970709303 4:18843097-18843119 CCATTCGTGGATCCTGGGTTCTT No data
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data
970709305_970709308 5 Left 970709305 4:18843122-18843144 CCCATGTACAAGAAGAATGAAGT No data
Right 970709308 4:18843150-18843172 GGACAACCAAAGAGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type