ID: 970720580

View in Genome Browser
Species Human (GRCh38)
Location 4:18984037-18984059
Sequence TAGATTATAAAGCACAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970720576_970720580 14 Left 970720576 4:18984000-18984022 CCTTAGCTAGACCACACATGCTA No data
Right 970720580 4:18984037-18984059 TAGATTATAAAGCACAGGCGTGG No data
970720575_970720580 15 Left 970720575 4:18983999-18984021 CCCTTAGCTAGACCACACATGCT No data
Right 970720580 4:18984037-18984059 TAGATTATAAAGCACAGGCGTGG No data
970720577_970720580 3 Left 970720577 4:18984011-18984033 CCACACATGCTATCTTTCTAAGC No data
Right 970720580 4:18984037-18984059 TAGATTATAAAGCACAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970720580 Original CRISPR TAGATTATAAAGCACAGGCG TGG Intergenic
No off target data available for this crispr