ID: 970723160

View in Genome Browser
Species Human (GRCh38)
Location 4:19011135-19011157
Sequence GTGGCTATTTAAAGGCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970723152_970723160 18 Left 970723152 4:19011094-19011116 CCTTCAGGCAAGGCAGGCAGTAG No data
Right 970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG No data
970723158_970723160 -9 Left 970723158 4:19011121-19011143 CCTGGGCAGATAATGTGGCTATT No data
Right 970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG No data
970723151_970723160 19 Left 970723151 4:19011093-19011115 CCCTTCAGGCAAGGCAGGCAGTA No data
Right 970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970723160 Original CRISPR GTGGCTATTTAAAGGCATCC TGG Intergenic
No off target data available for this crispr