ID: 970733717

View in Genome Browser
Species Human (GRCh38)
Location 4:19140682-19140704
Sequence GCACCCCGCCTGGCAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970733711_970733717 12 Left 970733711 4:19140647-19140669 CCTTATAATCATGGTGGAAGGCA No data
Right 970733717 4:19140682-19140704 GCACCCCGCCTGGCAAAAAGAGG No data
970733707_970733717 21 Left 970733707 4:19140638-19140660 CCTTAGGAACCTTATAATCATGG No data
Right 970733717 4:19140682-19140704 GCACCCCGCCTGGCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970733717 Original CRISPR GCACCCCGCCTGGCAAAAAG AGG Intergenic
No off target data available for this crispr