ID: 970735777

View in Genome Browser
Species Human (GRCh38)
Location 4:19165833-19165855
Sequence TGTCTTTCTTACGGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970735777_970735782 15 Left 970735777 4:19165833-19165855 CCAACAAAACCGTAAGAAAGACA No data
Right 970735782 4:19165871-19165893 AGACAAATCAGAAGGAGTCTGGG No data
970735777_970735783 24 Left 970735777 4:19165833-19165855 CCAACAAAACCGTAAGAAAGACA No data
Right 970735783 4:19165880-19165902 AGAAGGAGTCTGGGACCTTAAGG No data
970735777_970735781 14 Left 970735777 4:19165833-19165855 CCAACAAAACCGTAAGAAAGACA No data
Right 970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG No data
970735777_970735780 7 Left 970735777 4:19165833-19165855 CCAACAAAACCGTAAGAAAGACA No data
Right 970735780 4:19165863-19165885 AGGAAAGCAGACAAATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970735777 Original CRISPR TGTCTTTCTTACGGTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr