ID: 970735780

View in Genome Browser
Species Human (GRCh38)
Location 4:19165863-19165885
Sequence AGGAAAGCAGACAAATCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970735778_970735780 -2 Left 970735778 4:19165842-19165864 CCGTAAGAAAGACAAAAGCATAG No data
Right 970735780 4:19165863-19165885 AGGAAAGCAGACAAATCAGAAGG No data
970735776_970735780 25 Left 970735776 4:19165815-19165837 CCTGAAGACAAAAGCAAGCCAAC No data
Right 970735780 4:19165863-19165885 AGGAAAGCAGACAAATCAGAAGG No data
970735777_970735780 7 Left 970735777 4:19165833-19165855 CCAACAAAACCGTAAGAAAGACA No data
Right 970735780 4:19165863-19165885 AGGAAAGCAGACAAATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970735780 Original CRISPR AGGAAAGCAGACAAATCAGA AGG Intergenic
No off target data available for this crispr