ID: 970735783

View in Genome Browser
Species Human (GRCh38)
Location 4:19165880-19165902
Sequence AGAAGGAGTCTGGGACCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970735778_970735783 15 Left 970735778 4:19165842-19165864 CCGTAAGAAAGACAAAAGCATAG No data
Right 970735783 4:19165880-19165902 AGAAGGAGTCTGGGACCTTAAGG No data
970735777_970735783 24 Left 970735777 4:19165833-19165855 CCAACAAAACCGTAAGAAAGACA No data
Right 970735783 4:19165880-19165902 AGAAGGAGTCTGGGACCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970735783 Original CRISPR AGAAGGAGTCTGGGACCTTA AGG Intergenic
No off target data available for this crispr