ID: 970738116

View in Genome Browser
Species Human (GRCh38)
Location 4:19198142-19198164
Sequence CCGCAAACAGCAGTGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970738108_970738116 23 Left 970738108 4:19198096-19198118 CCTGCTGGATCCAGAGGGATGGA 0: 14
1: 44
2: 107
3: 135
4: 303
Right 970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG No data
970738106_970738116 24 Left 970738106 4:19198095-19198117 CCCTGCTGGATCCAGAGGGATGG No data
Right 970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG No data
970738110_970738116 13 Left 970738110 4:19198106-19198128 CCAGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970738116 Original CRISPR CCGCAAACAGCAGTGGTGCA CGG Intergenic
No off target data available for this crispr