ID: 970742320

View in Genome Browser
Species Human (GRCh38)
Location 4:19252322-19252344
Sequence CTGTTGGCACAGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970742320_970742328 -3 Left 970742320 4:19252322-19252344 CCCTCCTGACTCTGTGCCAACAG No data
Right 970742328 4:19252342-19252364 CAGCAGTGGGGGAAACTCTGTGG No data
970742320_970742330 7 Left 970742320 4:19252322-19252344 CCCTCCTGACTCTGTGCCAACAG No data
Right 970742330 4:19252352-19252374 GGAAACTCTGTGGCAGAGGCAGG No data
970742320_970742329 3 Left 970742320 4:19252322-19252344 CCCTCCTGACTCTGTGCCAACAG No data
Right 970742329 4:19252348-19252370 TGGGGGAAACTCTGTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970742320 Original CRISPR CTGTTGGCACAGAGTCAGGA GGG (reversed) Intergenic
No off target data available for this crispr