ID: 970743585

View in Genome Browser
Species Human (GRCh38)
Location 4:19267166-19267188
Sequence CTGCTTTACCTCAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970743585_970743588 20 Left 970743585 4:19267166-19267188 CCTTTTTTCCTGAGGTAAAGCAG No data
Right 970743588 4:19267209-19267231 GCACACATACTTACACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970743585 Original CRISPR CTGCTTTACCTCAGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr