ID: 970744072

View in Genome Browser
Species Human (GRCh38)
Location 4:19274241-19274263
Sequence TTTTGCACACAGATGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970744065_970744072 24 Left 970744065 4:19274194-19274216 CCTCTGTCAAAAGGATTCCCAGT No data
Right 970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG No data
970744069_970744072 -4 Left 970744069 4:19274222-19274244 CCTTTATTTAGCAGCACATTTTT No data
Right 970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG No data
970744067_970744072 7 Left 970744067 4:19274211-19274233 CCCAGTTAGGACCTTTATTTAGC No data
Right 970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG No data
970744068_970744072 6 Left 970744068 4:19274212-19274234 CCAGTTAGGACCTTTATTTAGCA No data
Right 970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970744072 Original CRISPR TTTTGCACACAGATGGGACA AGG Intergenic
No off target data available for this crispr