ID: 970744764

View in Genome Browser
Species Human (GRCh38)
Location 4:19281469-19281491
Sequence TTTTACAGGCACAGGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970744754_970744764 20 Left 970744754 4:19281426-19281448 CCCCCACAGCTGCTTTCACAGTC No data
Right 970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG No data
970744756_970744764 18 Left 970744756 4:19281428-19281450 CCCACAGCTGCTTTCACAGTCTG No data
Right 970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG No data
970744757_970744764 17 Left 970744757 4:19281429-19281451 CCACAGCTGCTTTCACAGTCTGG No data
Right 970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG No data
970744755_970744764 19 Left 970744755 4:19281427-19281449 CCCCACAGCTGCTTTCACAGTCT No data
Right 970744764 4:19281469-19281491 TTTTACAGGCACAGGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970744764 Original CRISPR TTTTACAGGCACAGGGTGCA AGG Intergenic
No off target data available for this crispr