ID: 970759304

View in Genome Browser
Species Human (GRCh38)
Location 4:19465057-19465079
Sequence GAGAACATACCCATGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970759303_970759304 11 Left 970759303 4:19465023-19465045 CCACACACATGCTAAGCAGCTGA No data
Right 970759304 4:19465057-19465079 GAGAACATACCCATGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970759304 Original CRISPR GAGAACATACCCATGAACAA TGG Intergenic
No off target data available for this crispr