ID: 970761041

View in Genome Browser
Species Human (GRCh38)
Location 4:19487058-19487080
Sequence CATTATAAGCAGGAACGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970761036_970761041 24 Left 970761036 4:19487011-19487033 CCTTTAAAGATGTGTAGTATTTT No data
Right 970761041 4:19487058-19487080 CATTATAAGCAGGAACGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970761041 Original CRISPR CATTATAAGCAGGAACGGCA AGG Intergenic
No off target data available for this crispr